| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.132329 |
| Chromosome: | chromosome 6 |
| Location: | 7477253 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g300250 | TTL10 | (1 of 1) K16600 - tubulin polyglutamylase TTLL2 [EC:6.-.-.-] (TTLL2); Putative tubulin tyrosine ligase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCACCTTGACGCTGCCTGTCTCCGACGT |
| Internal bar code: | CCCGGACGATCCGCCGACGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 219 |
| LEAP-Seq percent confirming: | 98.0 |
| LEAP-Seq n confirming: | 49 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAAAGCTAGGATGGGGTTG |
| Suggested primer 2: | TGAGCCATAGTCGCTGTCAC |