| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.132341 |
| Chromosome: | chromosome 3 |
| Location: | 5447371 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g185250 | SSS2,SSII | (1 of 1) IPR001296//IPR011835//IPR013534//IPR015421 - Glycosyl transferase, family 1 // Bacterial/plant glycogen synthase // Starch synthase, catalytic domain // Pyridoxal phosphate-dependent transferase, major region, subdomain 1; Soluble starch synthase II | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATAGCCCTGAGACTCACGTCTCCCGCAGA |
| Internal bar code: | AGCGGGAGAGCGCGGCGGCGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1041 |
| LEAP-Seq percent confirming: | 99.1936 |
| LEAP-Seq n confirming: | 9595 |
| LEAP-Seq n nonconfirming: | 78 |
| LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCGTATGTCACAGTGCGTC |
| Suggested primer 2: | GAGCTGAACGAGGAGTACCG |