Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.132361 |
Chromosome: | chromosome 17 |
Location: | 2189662 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g713150 | FAS8,FLA3 | FAS1 domain containing protein;; (1 of 21) PF02469 - Fasciclin domain (Fasciclin) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCGAGCTCGCGGTGCAGTCACTCTCAA |
Internal bar code: | ACGGGAGCTAGGATACGGGAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 965 |
LEAP-Seq percent confirming: | 99.3215 |
LEAP-Seq n confirming: | 7173 |
LEAP-Seq n nonconfirming: | 49 |
LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAATGGAGCTCTGGATGGAT |
Suggested primer 2: | CACCCCCTCACTCTTTGTGT |