| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.132395 |
| Chromosome: | chromosome 7 |
| Location: | 2437261 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g328950 | (1 of 1) PTHR12277:SF51 - ALPHA/BETA HYDROLASE FOLD-1 DOMAIN-CONTAINING PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACAACGCGGCAGGTGAACAAACGGGGCAT |
| Internal bar code: | AACAAACCCCAACGGCGGACCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 639 |
| LEAP-Seq percent confirming: | 99.8236 |
| LEAP-Seq n confirming: | 2263 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGATCAATCCAGGTCGCTT |
| Suggested primer 2: | GCGTGTGGCATTGAGAGTTA |