Insertion junction: LMJ.RY0402.132442_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.132442
Chromosome:chromosome_6
Location:1884160
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g263200 antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):GTTTGTGTGACACTTCGTCTTGTATGCGGC
Internal bar code:ATTGTTGCATCCACGCTCTTAT

Confirmation - LEAP-Seq

LEAP-Seq distance:455
LEAP-Seq percent confirming:96.8685
LEAP-Seq n confirming:464
LEAP-Seq n nonconfirming:15
LEAP-Seq n unique pos:4

Suggested primers for confirmation by PCR

Suggested primer 1:AAACGTCGTAACCTGCCATC
Suggested primer 2:GATGGATGTTCTTCTGCGGT