| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.132456 |
| Chromosome: | chromosome 6 |
| Location: | 349897 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g251550 | SPP3,SPPA1-3,SPP1C | Signal peptide peptidase; (1 of 1) IPR002142//IPR029045 - Peptidase S49 // ClpP/crotonase-like domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGATGCCGCCTGTGACGGTGCCCGGCTG |
| Internal bar code: | GCCGTTAAAGTTGGAGTACTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1045 |
| LEAP-Seq percent confirming: | 99.4505 |
| LEAP-Seq n confirming: | 362 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGCGAGTGCCTACCTTTTG |
| Suggested primer 2: | TGTAAGCAGGTCGTGACAGC |