Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.132459 |
Chromosome: | chromosome 9 |
Location: | 6877394 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g410100 | putative Cation-transporting ATPase; (1 of 2) PF00122//PF00689//PF00690//PF00702//PF13246 - E1-E2 ATPase (E1-E2_ATPase) // Cation transporting ATPase, C-terminus (Cation_ATPase_C) // Cation transporter/ATPase, N-terminus (Cation_ATPase_N) // haloacid dehalogenase-like hydrolase (Hydrolase) // Cation transport ATPase (P-type) (Cation_ATPase) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGCAACCTCGTTGGTCGGGCTGTCCCTT |
Internal bar code: | GGACCTATATTTATGGCTCAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 646 |
LEAP-Seq percent confirming: | 98.9754 |
LEAP-Seq n confirming: | 483 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGTCATGGTTGTTGTTGGC |
Suggested primer 2: | ACCGGAAGTTCTGAAACCCT |