| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.132500 |
| Chromosome: | chromosome 10 |
| Location: | 19391 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g417550 | CLPS3,CLPT3 | (1 of 2) 3.6.4.10 - Non-chaperonin molecular chaperone ATPase / Molecular chaperone Hsc70 ATPase; Additional subunit of chloroplast ClpP complex | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGTGGAGGATTCGCATACAGGCTCAGCT |
| Internal bar code: | TCTTCATATCTTCCGAAGAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 824 |
| LEAP-Seq percent confirming: | 99.6941 |
| LEAP-Seq n confirming: | 9778 |
| LEAP-Seq n nonconfirming: | 30 |
| LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTAACCGCTGCTATTGCT |
| Suggested primer 2: | CTGGTGAGGTATGTGGGCTT |