Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.132534 |
Chromosome: | chromosome 2 |
Location: | 6201511 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g113850 | PBGD2,HMBS,HEM3 | (1 of 1) PTHR11557//PTHR11557:SF0 - PORPHOBILINOGEN DEAMINASE // PORPHOBILINOGEN DEAMINASE; Porphobilinogen deaminase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCTCGCGACTGATACTGCTGCTGGTGCT |
Internal bar code: | CGGCGAGGACATGGGACGTGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 937 |
LEAP-Seq percent confirming: | 93.9475 |
LEAP-Seq n confirming: | 26729 |
LEAP-Seq n nonconfirming: | 1722 |
LEAP-Seq n unique pos: | 120 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCACACACACACACCCCTAC |
Suggested primer 2: | ACAGTCGTGTTTAGGGGCAC |