| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.132560 |
| Chromosome: | chromosome 14 |
| Location: | 127030 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g608452 | (1 of 1) K11366 - ubiquitin carboxyl-terminal hydrolase 22/27/51 [EC:3.4.19.12] (USP22_27_51, UBP8) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGCGTCGTCGTGCCGTTTTTTAACGTTT |
| Internal bar code: | CTGCCCCTCGGCCATCGGCAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1370 |
| LEAP-Seq percent confirming: | 99.4555 |
| LEAP-Seq n confirming: | 1096 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGGGGACAGGAGAGGTAG |
| Suggested primer 2: | CCATGGGATGGTGTGTATCA |