| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.132670 |
| Chromosome: | chromosome 6 |
| Location: | 7726492 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g302000 | MFP31,MFP1 | Major facilitator superfamily transporter; (1 of 2) PF05977 - Transmembrane secretion effector (MFS_3) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACTTGTACTGGCGCATACACCATGGTCCA |
| Internal bar code: | TGATCGTGTGTTCGTATGTCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 706 |
| LEAP-Seq percent confirming: | 95.5579 |
| LEAP-Seq n confirming: | 3614 |
| LEAP-Seq n nonconfirming: | 168 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACACACGGATATGCCTC |
| Suggested primer 2: | CTTGGTTGCCTTTGGTCACT |