| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.132714 |
| Chromosome: | chromosome 10 |
| Location: | 4309198 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g450879 | (1 of 1) K14859 - ribosome biogenesis protein SSF1/2 (SSF1_2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCCGCTCACCACCAGGGTTTTACATCAA |
| Internal bar code: | TACTATCATTTCATGCCCCTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 93 |
| LEAP-Seq percent confirming: | 99.3692 |
| LEAP-Seq n confirming: | 3623 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCACATGACATACACGCA |
| Suggested primer 2: | TTTGGTTTACTTTGGGCTGG |