| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.132721 |
| Chromosome: | chromosome 6 |
| Location: | 7022974 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g296850 | FAP81,DLEC1 | (1 of 8) IPR008962 - PapD-like; Flagellar Associated Protein 81 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGACATGACCAGCTGCTAACACGCGATC |
| Internal bar code: | TCGGTGAAAACCTGCGCCAGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 174 |
| LEAP-Seq percent confirming: | 97.7273 |
| LEAP-Seq n confirming: | 1419 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAGTTCCTGGTCACCTTCA |
| Suggested primer 2: | CTCCTCCTCCTCTTGCACC |