Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.132726 |
Chromosome: | chromosome 12 |
Location: | 6812032 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g561550 | CDS1 | Mitochondrial half-size ABC transporter, membrane protein; (1 of 2) K05661 - ATP-binding cassette, subfamily B (MDR/TAP), member 6 (ABCB6) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGGCCAGGTGCGGCGGCAAAGAGGGAGG |
Internal bar code: | TGGACAGGTCCGCAACAGCTCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 285 |
LEAP-Seq percent confirming: | 99.6764 |
LEAP-Seq n confirming: | 308 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGACGATTGTGTCGTGGAT |
Suggested primer 2: | GGCATCAGAGTCAACAAGCA |