Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.132744 |
Chromosome: | chromosome 10 |
Location: | 4892926 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g454650 | RPC5 | (1 of 1) K14721 - DNA-directed RNA polymerase III subunit RPC5 (RPC5, POLR3E); DNA-directed RNA polymerase III, 8 kD | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATACGCGAGAACTGCGAGGGTGCCAAACC |
Internal bar code: | GTTGGAGATCTGGGTCGTTAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 667 |
LEAP-Seq percent confirming: | 99.2278 |
LEAP-Seq n confirming: | 1285 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTAGGTTGGGAAGGTAGCG |
Suggested primer 2: | TTCCATTTGAATCATGGGGT |