| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.132800 |
| Chromosome: | chromosome 16 |
| Location: | 6064075 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g676200 | (1 of 3) PTHR10751:SF2 - GUANYLATE-BINDING PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTTTCGTTTTTTTTAACACACACACAAA |
| Internal bar code: | CGTCTGCGGGCTGAGTTCGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 247 |
| LEAP-Seq percent confirming: | 38.6373 |
| LEAP-Seq n confirming: | 24447 |
| LEAP-Seq n nonconfirming: | 38826 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAGGGACCTTACCAACCTG |
| Suggested primer 2: | TTCAACGTTAACCCCACCAT |