| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.132854 |
| Chromosome: | chromosome 16 |
| Location: | 7360626 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g684939 | (1 of 4) PTHR11207//PTHR11207:SF0 - RIBONUCLEASE III // RIBONUCLEASE 3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCAGGCCCTGGTGACCTCATGTGGCTACC |
| Internal bar code: | GACTGATCTCGGACTTGAAACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 167 |
| LEAP-Seq percent confirming: | 72.7273 |
| LEAP-Seq n confirming: | 64 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGAAGAAGCAATGCCTGG |
| Suggested primer 2: | TAGGCAAGAGCGGCTATGTT |