Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.132874 |
Chromosome: | chromosome 12 |
Location: | 6128803 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g536000 | ALA2 | (1 of 3) K14802 - phospholipid-transporting ATPase [EC:3.6.3.1] (DRS2, ATP8A); ATPase, aminophospholipid transporter | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTGGCTATGCAGTTCCGTGCAGGGCAGG |
Internal bar code: | GTATCGGGGTCTTCCAGACTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 191 |
LEAP-Seq percent confirming: | 99.7918 |
LEAP-Seq n confirming: | 1438 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCCAAGAATAAGTTGCCGC |
Suggested primer 2: | CAAAAGAAATAGCGCAAGGC |