Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.132977 |
Chromosome: | chromosome 12 |
Location: | 1254430 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g489300 | (1 of 2) IPR000742//IPR001881//IPR009030 - EGF-like domain // EGF-like calcium-binding domain // Insulin-like growth factor binding protein, N-terminal | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCAACACTCAACCCCACGCCCGCACCCG |
Internal bar code: | CTCCCAGTCTTTTGCAGTAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1707 |
LEAP-Seq percent confirming: | 99.4302 |
LEAP-Seq n confirming: | 10994 |
LEAP-Seq n nonconfirming: | 63 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCAAGCCACACAAACAGTG |
Suggested primer 2: | GTGTGCGTCACCATCATAGG |