| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.133002 |
| Chromosome: | chromosome 13 |
| Location: | 3943159 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g590750 | HTB21,HTB37 | (1 of 27) K11252 - histone H2B (H2B); Histone H2B | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAGAACCCTACTTCAGCACATTCCTTAT |
| Internal bar code: | GTATTACATTGGGCGCAAGTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 794 |
| LEAP-Seq percent confirming: | 97.9167 |
| LEAP-Seq n confirming: | 893 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCAACAGCCCTTTATACCG |
| Suggested primer 2: | GCACCTTTTGACTTGGTGGT |