| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.133009 |
| Chromosome: | chromosome 1 |
| Location: | 6426439 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g045700 | CAT2 | (1 of 1) 1.11.1.21 - Catalase peroxidase; Catalase/peroxidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAGGGAAAGACGACGGCACACGCACTCAT |
| Internal bar code: | CAGAACCTGCACCCTGCAATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 258 |
| LEAP-Seq percent confirming: | 88.6525 |
| LEAP-Seq n confirming: | 125 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCAACTTTCAAGCAATCG |
| Suggested primer 2: | CCTCCTTTACACCACCTCCA |