| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.133067 |
| Chromosome: | chromosome 12 |
| Location: | 8700029 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g546200 | RBL5 | Rhomboid-like protein; (1 of 4) PTHR22936//PTHR22936:SF32 - RHOMBOID-RELATED // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGCATACCGTGAACACCGCCCTGCCACT |
| Internal bar code: | GCTTAAAGGTCGTAATTCATTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1004 |
| LEAP-Seq percent confirming: | 99.3197 |
| LEAP-Seq n confirming: | 7008 |
| LEAP-Seq n nonconfirming: | 48 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGTAGGAGGCAGGGATGGT |
| Suggested primer 2: | CCTGGGTGCATCCACTACTT |