| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.133079 |
| Chromosome: | chromosome 16 |
| Location: | 656948 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g691750 | AMI1 | putative formamidase/acetamidase; (1 of 1) 3.5.1.49 - Formamidase / Formamide amidohydrolase | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCCCAGCGCAGGCGCCCATACTGCAAGC |
| Internal bar code: | TATCTTCCTGGCAGGAGCGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 975 |
| LEAP-Seq percent confirming: | 99.7536 |
| LEAP-Seq n confirming: | 8907 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTGAGCTGCCCTGTAAGT |
| Suggested primer 2: | CCCGGCTCTTTAACACACAT |