| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.133191 |
| Chromosome: | chromosome 1 |
| Location: | 4839175 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g033550 | PDI2 | (1 of 1) PTHR18929:SF87 - PROTEIN C03H12.1, ISOFORM A; Protein disulfide isomerase 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCCCTCCCACAACTTCCCCCTTTCCTCC |
| Internal bar code: | GTTTCGGTCCGGCGGCGATAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 720 |
| LEAP-Seq percent confirming: | 91.5767 |
| LEAP-Seq n confirming: | 1272 |
| LEAP-Seq n nonconfirming: | 117 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTTCGACTGACGAAGCACA |
| Suggested primer 2: | AGCACGCCAGAAAGATCACT |