Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.133197 |
Chromosome: | chromosome 10 |
Location: | 2581956 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g437000 | (1 of 2) PTHR30289 - UNCHARACTERIZED PROTEIN YBCL-RELATED; Conserved Protein with YHYH Domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCTACGCCCGCAGTATGGTTTGTGGGCT |
Internal bar code: | GTGGGGGGTTCATTTATACCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 825 |
LEAP-Seq percent confirming: | 99.4092 |
LEAP-Seq n confirming: | 2019 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GATTCCCAACCCCTTTCCTA |
Suggested primer 2: | ACCTGCACTTCGGGTGTATC |