| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.133205 |
| Chromosome: | chromosome 6 |
| Location: | 5920987 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g288550 | ECP76 | 76 kDa extracellular polypeptide; (1 of 5) PF06742//PF06863 - Protein of unknown function (DUF1214) (DUF1214) // Protein of unknown function (DUF1254) (DUF1254) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGACGCGCTGGCGGTGAGCACGTGGCTAGT |
| Internal bar code: | GTTGCTACATTTGGGATAATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 606 |
| LEAP-Seq percent confirming: | 98.4699 |
| LEAP-Seq n confirming: | 2703 |
| LEAP-Seq n nonconfirming: | 42 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGTGATGGTGTAGTCGGC |
| Suggested primer 2: | GGCACTGCCTGTAAACCAAT |