| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.133232 |
| Chromosome: | chromosome 12 |
| Location: | 7725472 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g553900 | CNG2 | (1 of 1) K04905 - potassium voltage-gated channel Eag-related subfamily H member 2 (KCNH2); Cyclic-nucleotide gated potassium channel | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACTCCCGCGGCACGAAGACGCCGTCTGGC |
| Internal bar code: | GAGATGGGGTACGAATGCGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 176 |
| LEAP-Seq percent confirming: | 96.5463 |
| LEAP-Seq n confirming: | 1230 |
| LEAP-Seq n nonconfirming: | 44 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTTCGGTAATTTCTGCCGT |
| Suggested primer 2: | GACGAGCTGGAGTGGATCTC |