| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.133284 |
| Chromosome: | chromosome 7 |
| Location: | 5114630 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g347900 | (1 of 2) IPR001680//IPR001810//IPR017986 - WD40 repeat // F-box domain // WD40-repeat-containing domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTATGCATTCCCGTCTTGCACGTCAGTG |
| Internal bar code: | CCTCGGACCCGGGTCGCCGCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 970 |
| LEAP-Seq percent confirming: | 99.32 |
| LEAP-Seq n confirming: | 6573 |
| LEAP-Seq n nonconfirming: | 45 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTGGTGGGCTCTACGTCAC |
| Suggested primer 2: | CAAAGGCACATTGGGAGAGT |