| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.133306 |
| Chromosome: | chromosome 11 |
| Location: | 561638 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467607 | (1 of 3) 2.7.11.17//2.7.11.25 - Calcium/calmodulin-dependent protein kinase / Microtubule-associated protein 2 kinase // Mitogen-activated protein kinase kinase kinase / MLTK | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGGGGTGCTGTGTTTTAGGGCCTGCGGTT |
| Internal bar code: | TTTGGTGCGGAAAAGTAACGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 918 |
| LEAP-Seq percent confirming: | 98.3961 |
| LEAP-Seq n confirming: | 3006 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTAGGCCTTGATGACGCAG |
| Suggested primer 2: | GACCATGGTTGCAGTTGTTG |