| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.133349 |
| Chromosome: | chromosome 16 |
| Location: | 913053 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g648350 | PDY2 | (1 of 2) 1.5.5.2 - Proline dehydrogenase; Proline dehydrogenase | CDS/intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGACTACGTGAGCTGGACCTCGCGCCTG |
| Internal bar code: | ACGTGACAGGCACCGGCCGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 463 |
| LEAP-Seq percent confirming: | 95.0787 |
| LEAP-Seq n confirming: | 966 |
| LEAP-Seq n nonconfirming: | 50 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGCTTGTACGCACACACT |
| Suggested primer 2: | CTGGAAGTAGGAGTGCTCGG |