| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.133412 |
| Chromosome: | chromosome 6 |
| Location: | 6957142 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g296300 | SRR1 | Scavenger receptor cysteine rich (SRCR) protein; (1 of 20) IPR001190//IPR017448 - SRCR domain // SRCR-like domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGACCCCGCCGCACACGCCTTCTGGGCGC |
| Internal bar code: | GTCCGCCCACAGATTGTCGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 398 |
| LEAP-Seq percent confirming: | 90.3017 |
| LEAP-Seq n confirming: | 419 |
| LEAP-Seq n nonconfirming: | 45 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTACATAAGCCGCACCACC |
| Suggested primer 2: | CCACACCTGAAGGTCCAACT |