Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.133428 |
Chromosome: | chromosome 17 |
Location: | 3541734 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g725350 | PSL4,GLC2B | Glucosidase IIb; (1 of 1) K08288 - protein kinase C substrate 80K-H (PRKCSH) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCAAAGGACGAGTTGTAGGCGGGCTGTA |
Internal bar code: | GGGGTAGGCTATTCTGAGTTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 863 |
LEAP-Seq percent confirming: | 98.6257 |
LEAP-Seq n confirming: | 17798 |
LEAP-Seq n nonconfirming: | 248 |
LEAP-Seq n unique pos: | 85 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACTGCTGTATGGTGGTGCC |
Suggested primer 2: | ATTGCAAACACGCATGTGAT |