| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.133533 |
| Chromosome: | chromosome 6 |
| Location: | 419890 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g252200 | TOC34 | Translocon at the outer envelope membrane of chloroplasts, receptor subunit; (1 of 1) PTHR10903//PTHR10903:SF43 - GTPASE, IMAP FAMILY MEMBER-RELATED // GTP-BINDING PROTEIN A | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACTGTCCCCTTTGCCGGCCCCATCGTACA |
| Internal bar code: | ATCCGATCATCAGTGGGTCCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 443 |
| LEAP-Seq percent confirming: | 99.4212 |
| LEAP-Seq n confirming: | 1546 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAAGCATATGATCGGAGGG |
| Suggested primer 2: | TGGAGAACAGTGAGACGTGC |