Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.133600 |
Chromosome: | chromosome 1 |
Location: | 7992030 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g069472 | TSC2 | Putative organellar cysteinyl tRNA synthetase; (1 of 2) 6.1.1.16 - Cysteine--tRNA ligase / Cysteinyl-tRNA synthetase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTATCTGAAGTTGCATACAGGCATTCCAGC |
Internal bar code: | CGGTAAGGGTTTCCTGCCCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 544 |
LEAP-Seq percent confirming: | 99.6061 |
LEAP-Seq n confirming: | 6575 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTGGTTTAGTTTGGGCTGG |
Suggested primer 2: | TCCCACGGTATCGACTTTTC |