Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.133610 |
Chromosome: | chromosome 16 |
Location: | 2504337 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g660900 | KIL10 | Putative kinesin-like motor protein; (1 of 1) PTHR24115//PTHR24115:SF0 - FAMILY NOT NAMED // KINESIN-LIKE PROTEIN KLP10A | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGCCCAGGAGGCCACAGCTGTGGAGCAA |
Internal bar code: | TGGGGGCTCGGTGTGCGGACGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 451 |
LEAP-Seq percent confirming: | 99.2481 |
LEAP-Seq n confirming: | 132 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTACGTTGCACATGATTGCC |
Suggested primer 2: | CTTCCTGGAGACCAGCTACG |