| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.133722 |
| Chromosome: | chromosome 13 |
| Location: | 3735482 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g589400 | PRL6 | (1 of 14) PTHR10334 - CYSTEINE-RICH SECRETORY PROTEIN-RELATED; Predicted extracellular protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGTCATGCTTACCGCGACAGTAGTGCGT |
| Internal bar code: | GGTAAGGGATCACCGCGTCGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 83 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGATCTTCAAGACGCACTG |
| Suggested primer 2: | ATGAAACACAGGTTGGCCTC |