| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.133727 |
| Chromosome: | chromosome 2 |
| Location: | 1152083 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g081650 | (1 of 1) PTHR31515//PTHR31515:SF3 - FAMILY NOT NAMED // GENOMIC DNA, CHROMOSOME 3, BAC CLONE: T19N8 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACGCACGCACCCGCGTTGCGCCCCGCCGA |
| Internal bar code: | GCGCTGGCGGGCGTGCGCGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 83 |
| LEAP-Seq percent confirming: | 5.3175 |
| LEAP-Seq n confirming: | 103 |
| LEAP-Seq n nonconfirming: | 1834 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCCTTTCCCACTAAACCAC |
| Suggested primer 2: | GAGTGACGGGATCGTTTCAT |