| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.133816 |
| Chromosome: | chromosome 3 |
| Location: | 3248468 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g165750 | (1 of 1) K03018 - DNA-directed RNA polymerase III subunit RPC1 (RPC1, POLR3A) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACAAGCCCTGTATGTGCTCAGCACGTTT |
| Internal bar code: | AAAAGTTATCCGGTTCCCCGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1054 |
| LEAP-Seq percent confirming: | 99.0123 |
| LEAP-Seq n confirming: | 2005 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCAGGTGTGGTCAGGTGTG |
| Suggested primer 2: | CGTTGTTGAGGAGGAAGAGC |