| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.133866 |
| Chromosome: | chromosome 10 |
| Location: | 1658114 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g429800 | COQ8,ABC1 | Ubiquinone biosynthesis protein; (1 of 1) PTHR10566:SF65 - UBIQUINONE BIOSYNTHESIS PROTEIN COQ-8 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAAGGACAGCAAACTTTGCACGCGCGTCT |
| Internal bar code: | ATTTCGTTCGGCCAGTAGACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 589 |
| LEAP-Seq percent confirming: | 98.9918 |
| LEAP-Seq n confirming: | 2651 |
| LEAP-Seq n nonconfirming: | 27 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTTTACAACCCCACCCAC |
| Suggested primer 2: | CTATGGGCTAATTTGGGGGT |