Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.133921 |
Chromosome: | chromosome 17 |
Location: | 2078322 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g712100 | MDAR1,PNO2 | Monodehydroascorbate reductase 1; (1 of 1) K08232 - monodehydroascorbate reductase (NADH) (E1.6.5.4) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTAACATTGGTGGGTAGTAAACTGCGAA |
Internal bar code: | CGGGGGGGCCAAGGTACCACTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 632 |
LEAP-Seq percent confirming: | 98.0577 |
LEAP-Seq n confirming: | 3332 |
LEAP-Seq n nonconfirming: | 66 |
LEAP-Seq n unique pos: | 52 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATTGTGCGGGTACTGGAGAC |
Suggested primer 2: | CGCTTGCCCTAAGACAACTC |