| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.133985 |
| Chromosome: | chromosome 9 |
| Location: | 3677889 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g390763 | RAB2,FAP354 | Rab-like GTP-Binding Flagellar Associated Protein 354; (1 of 1) K07877 - Ras-related protein Rab-2A (RAB2A) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGTGGAGGTGCTCGGGCACACGTCACGC |
| Internal bar code: | CAGGAGCTGGCGGACCTGTGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 660 |
| LEAP-Seq percent confirming: | 99.8219 |
| LEAP-Seq n confirming: | 1681 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCACCACAAGGACTATCGC |
| Suggested primer 2: | GAGAGCGTAACGGCAAGAAG |