| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.134085 |
| Chromosome: | chromosome 7 |
| Location: | 4655502 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g344500 | GT90-10,GT90F10 | (1 of 2) K13667 - protein glucosyltransferase (RUMI, KTELC1); GT90 family protein 10 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGTTCAGGTGCGCCTGGGACTGTGGCTA |
| Internal bar code: | ATGCGAGATCCGATACACCAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 211 |
| LEAP-Seq percent confirming: | 99.7864 |
| LEAP-Seq n confirming: | 5139 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAAACGTCTCAAGCTCCTC |
| Suggested primer 2: | ATACAGCTCATTTCCCACCG |