| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.134089 |
| Chromosome: | chromosome 6 |
| Location: | 5241178 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g282251 | (1 of 12) IPR000104//IPR002893 - Antifreeze protein, type I // Zinc finger, MYND-type | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGTGGCGCGGAAACCAGAGAGGTACCCGA |
| Internal bar code: | GGGATTCTGACGAACAGCCCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 433 |
| LEAP-Seq percent confirming: | 98.851 |
| LEAP-Seq n confirming: | 8861 |
| LEAP-Seq n nonconfirming: | 103 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTGTGTGTGTGTGTGTGT |
| Suggested primer 2: | TTCACATCCCCGAAGAAGAC |