| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.134099 |
| Chromosome: | chromosome 6 |
| Location: | 5588176 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g285600 | MID,RWP5 | (1 of 16) PF02042 - RWP-RK domain (RWP-RK); RWP-RK transcription factor | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCGACATGAAAACCCAGACGACATAAAA |
| Internal bar code: | TAGACGCGTTCGGGCATGAGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 625 |
| LEAP-Seq percent confirming: | 99.9066 |
| LEAP-Seq n confirming: | 4280 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATTCCAACTGGTGGTGGAG |
| Suggested primer 2: | TTACACAAAACGCGAGCAAG |