| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.134227 |
| Chromosome: | chromosome 5 |
| Location: | 2970172 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g238322 | TSW2 | (1 of 2) 6.1.1.2 - Tryptophan--tRNA ligase / Tryptophanyl-tRNA synthetase; Putative tryptophanyl-tRNA synthetase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTCACCGGCTCACTCTGAACGTGCCCAC |
| Internal bar code: | CAGAGTGCTGATCCGTTGAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 681 |
| LEAP-Seq percent confirming: | 73.1011 |
| LEAP-Seq n confirming: | 3022 |
| LEAP-Seq n nonconfirming: | 1112 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGTGTCGGTGTCAGTGGAA |
| Suggested primer 2: | AGGGGAAAAGGGTCAGAAGA |