| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.134232 |
| Chromosome: | chromosome 14 |
| Location: | 377458 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g610450 | ZIP5 | (1 of 1) K14715 - solute carrier family 39 (zinc transporter), member 9 (SLC39A9, ZIP9); Zinc/iron transporter | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCGGATACTTGGGGTGGGTGCGCCTGAG |
| Internal bar code: | GCCCGCTGCCTCGTATCGGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 304 |
| LEAP-Seq percent confirming: | 99.6992 |
| LEAP-Seq n confirming: | 2652 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTCGGTTTCGTGTGTGTGT |
| Suggested primer 2: | CACCCACATACACTCCCTCC |