Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.134408 |
Chromosome: | chromosome 6 |
Location: | 8540466 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g308200 | (1 of 2) K09531 - DnaJ homolog subfamily C member 11 (DNAJC11) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGTAAAAGGTGATGCGGAAACGCATGCGG |
Internal bar code: | AGCGAGAAGTCCGCCCGCTCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 683 |
LEAP-Seq percent confirming: | 99.8225 |
LEAP-Seq n confirming: | 2812 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGGATCGTTTGACCAGTTC |
Suggested primer 2: | GTAGGGAGGTAGGGAGGTGC |