| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.134414 |
| Chromosome: | chromosome 1 |
| Location: | 6985585 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g050451 | TTL6 | (1 of 1) 1.2.1.24//6.3.2.25 - Succinate-semialdehyde dehydrogenase (NAD(+)) // Tubulin--tyrosine ligase / TTL; predicted tubulin tyrosine ligase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGATCAGAATGAACTAACCCCCCGGGGGCT |
| Internal bar code: | GGGCAGGCGCAGGTCCGCCGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 216 |
| LEAP-Seq percent confirming: | 73.7888 |
| LEAP-Seq n confirming: | 1782 |
| LEAP-Seq n nonconfirming: | 633 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCCCTAGCCTCTTCCCTC |
| Suggested primer 2: | CCTCTCACCTATGCTGGCTC |