| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.134428 |
| Chromosome: | chromosome 1 |
| Location: | 1943824 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g010350 | LIPB1,LPL1 | (1 of 1) PTHR10993//PTHR10993:SF7 - OCTANOYLTRANSFERASE // LIPOYLTRANSFERASE 2, MITOCHONDRIAL-RELATED; Lipoate protein ligase B | 3'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTGCAGGATACGGGCACTTGTGTTGGAG |
| Internal bar code: | GTGTATTCTGTGACACACAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 918 |
| LEAP-Seq percent confirming: | 96.0167 |
| LEAP-Seq n confirming: | 6653 |
| LEAP-Seq n nonconfirming: | 276 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACCGCACTTCATTACTGGG |
| Suggested primer 2: | CGCGCTGCTTAGCTTAGACT |