| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.134457 |
| Chromosome: | chromosome 3 |
| Location: | 78880 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g143827 | FBB7 | Flagellar/basal body protein 7; (1 of 1) IPR001680//IPR011047//IPR011048//IPR017986 - WD40 repeat // Quinonprotein alcohol dehydrogenase-like superfamily // Cytochrome cd1-nitrite reductase-like, haem d1 domain // WD40-repeat-containing domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGATTTAACCCTCGCCCCCTCACCTCGC |
| Internal bar code: | CCGTCGACCTCGAGCTCGGTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 757 |
| LEAP-Seq percent confirming: | 99.9364 |
| LEAP-Seq n confirming: | 1572 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGGCTGTACGATAAGGTC |
| Suggested primer 2: | CTTGGCGGTAAAGAGCAGTC |